ID: 1070642645

View in Genome Browser
Species Human (GRCh38)
Location 10:78180624-78180646
Sequence AGGCTGCAGTAACCGGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070642645_1070642650 -7 Left 1070642645 10:78180624-78180646 CCTCCACCCGGTTACTGCAGCCT No data
Right 1070642650 10:78180640-78180662 GCAGCCTGACCAAGTTTTCCGGG No data
1070642645_1070642653 10 Left 1070642645 10:78180624-78180646 CCTCCACCCGGTTACTGCAGCCT No data
Right 1070642653 10:78180657-78180679 TCCGGGCTCCCCCTTCTCCCTGG No data
1070642645_1070642655 11 Left 1070642645 10:78180624-78180646 CCTCCACCCGGTTACTGCAGCCT No data
Right 1070642655 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG No data
1070642645_1070642656 12 Left 1070642645 10:78180624-78180646 CCTCCACCCGGTTACTGCAGCCT No data
Right 1070642656 10:78180659-78180681 CGGGCTCCCCCTTCTCCCTGGGG No data
1070642645_1070642649 -8 Left 1070642645 10:78180624-78180646 CCTCCACCCGGTTACTGCAGCCT No data
Right 1070642649 10:78180639-78180661 TGCAGCCTGACCAAGTTTTCCGG No data
1070642645_1070642663 30 Left 1070642645 10:78180624-78180646 CCTCCACCCGGTTACTGCAGCCT No data
Right 1070642663 10:78180677-78180699 TGGGGACCCCATTCAATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070642645 Original CRISPR AGGCTGCAGTAACCGGGTGG AGG (reversed) Intergenic
No off target data available for this crispr