ID: 1070642646

View in Genome Browser
Species Human (GRCh38)
Location 10:78180627-78180649
Sequence GTCAGGCTGCAGTAACCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070642646_1070642653 7 Left 1070642646 10:78180627-78180649 CCACCCGGTTACTGCAGCCTGAC No data
Right 1070642653 10:78180657-78180679 TCCGGGCTCCCCCTTCTCCCTGG No data
1070642646_1070642655 8 Left 1070642646 10:78180627-78180649 CCACCCGGTTACTGCAGCCTGAC No data
Right 1070642655 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG No data
1070642646_1070642650 -10 Left 1070642646 10:78180627-78180649 CCACCCGGTTACTGCAGCCTGAC No data
Right 1070642650 10:78180640-78180662 GCAGCCTGACCAAGTTTTCCGGG No data
1070642646_1070642656 9 Left 1070642646 10:78180627-78180649 CCACCCGGTTACTGCAGCCTGAC No data
Right 1070642656 10:78180659-78180681 CGGGCTCCCCCTTCTCCCTGGGG No data
1070642646_1070642663 27 Left 1070642646 10:78180627-78180649 CCACCCGGTTACTGCAGCCTGAC No data
Right 1070642663 10:78180677-78180699 TGGGGACCCCATTCAATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070642646 Original CRISPR GTCAGGCTGCAGTAACCGGG TGG (reversed) Intergenic