ID: 1070642648

View in Genome Browser
Species Human (GRCh38)
Location 10:78180631-78180653
Sequence CTTGGTCAGGCTGCAGTAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070642648_1070642653 3 Left 1070642648 10:78180631-78180653 CCGGTTACTGCAGCCTGACCAAG No data
Right 1070642653 10:78180657-78180679 TCCGGGCTCCCCCTTCTCCCTGG No data
1070642648_1070642656 5 Left 1070642648 10:78180631-78180653 CCGGTTACTGCAGCCTGACCAAG No data
Right 1070642656 10:78180659-78180681 CGGGCTCCCCCTTCTCCCTGGGG No data
1070642648_1070642655 4 Left 1070642648 10:78180631-78180653 CCGGTTACTGCAGCCTGACCAAG No data
Right 1070642655 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG No data
1070642648_1070642663 23 Left 1070642648 10:78180631-78180653 CCGGTTACTGCAGCCTGACCAAG No data
Right 1070642663 10:78180677-78180699 TGGGGACCCCATTCAATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070642648 Original CRISPR CTTGGTCAGGCTGCAGTAAC CGG (reversed) Intergenic
No off target data available for this crispr