ID: 1070642649

View in Genome Browser
Species Human (GRCh38)
Location 10:78180639-78180661
Sequence TGCAGCCTGACCAAGTTTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070642644_1070642649 -7 Left 1070642644 10:78180623-78180645 CCCTCCACCCGGTTACTGCAGCC No data
Right 1070642649 10:78180639-78180661 TGCAGCCTGACCAAGTTTTCCGG No data
1070642645_1070642649 -8 Left 1070642645 10:78180624-78180646 CCTCCACCCGGTTACTGCAGCCT No data
Right 1070642649 10:78180639-78180661 TGCAGCCTGACCAAGTTTTCCGG No data
1070642643_1070642649 -3 Left 1070642643 10:78180619-78180641 CCTTCCCTCCACCCGGTTACTGC No data
Right 1070642649 10:78180639-78180661 TGCAGCCTGACCAAGTTTTCCGG No data
1070642640_1070642649 22 Left 1070642640 10:78180594-78180616 CCATGGGTAGTCCAAGGCACTCT No data
Right 1070642649 10:78180639-78180661 TGCAGCCTGACCAAGTTTTCCGG No data
1070642641_1070642649 11 Left 1070642641 10:78180605-78180627 CCAAGGCACTCTGTCCTTCCCTC No data
Right 1070642649 10:78180639-78180661 TGCAGCCTGACCAAGTTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070642649 Original CRISPR TGCAGCCTGACCAAGTTTTC CGG Intergenic