ID: 1070642650

View in Genome Browser
Species Human (GRCh38)
Location 10:78180640-78180662
Sequence GCAGCCTGACCAAGTTTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070642645_1070642650 -7 Left 1070642645 10:78180624-78180646 CCTCCACCCGGTTACTGCAGCCT No data
Right 1070642650 10:78180640-78180662 GCAGCCTGACCAAGTTTTCCGGG No data
1070642643_1070642650 -2 Left 1070642643 10:78180619-78180641 CCTTCCCTCCACCCGGTTACTGC No data
Right 1070642650 10:78180640-78180662 GCAGCCTGACCAAGTTTTCCGGG No data
1070642646_1070642650 -10 Left 1070642646 10:78180627-78180649 CCACCCGGTTACTGCAGCCTGAC No data
Right 1070642650 10:78180640-78180662 GCAGCCTGACCAAGTTTTCCGGG No data
1070642644_1070642650 -6 Left 1070642644 10:78180623-78180645 CCCTCCACCCGGTTACTGCAGCC No data
Right 1070642650 10:78180640-78180662 GCAGCCTGACCAAGTTTTCCGGG No data
1070642641_1070642650 12 Left 1070642641 10:78180605-78180627 CCAAGGCACTCTGTCCTTCCCTC No data
Right 1070642650 10:78180640-78180662 GCAGCCTGACCAAGTTTTCCGGG No data
1070642640_1070642650 23 Left 1070642640 10:78180594-78180616 CCATGGGTAGTCCAAGGCACTCT No data
Right 1070642650 10:78180640-78180662 GCAGCCTGACCAAGTTTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070642650 Original CRISPR GCAGCCTGACCAAGTTTTCC GGG Intergenic