ID: 1070642655

View in Genome Browser
Species Human (GRCh38)
Location 10:78180658-78180680
Sequence CCGGGCTCCCCCTTCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070642647_1070642655 5 Left 1070642647 10:78180630-78180652 CCCGGTTACTGCAGCCTGACCAA No data
Right 1070642655 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG No data
1070642643_1070642655 16 Left 1070642643 10:78180619-78180641 CCTTCCCTCCACCCGGTTACTGC No data
Right 1070642655 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG No data
1070642646_1070642655 8 Left 1070642646 10:78180627-78180649 CCACCCGGTTACTGCAGCCTGAC No data
Right 1070642655 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG No data
1070642645_1070642655 11 Left 1070642645 10:78180624-78180646 CCTCCACCCGGTTACTGCAGCCT No data
Right 1070642655 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG No data
1070642644_1070642655 12 Left 1070642644 10:78180623-78180645 CCCTCCACCCGGTTACTGCAGCC No data
Right 1070642655 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG No data
1070642651_1070642655 -9 Left 1070642651 10:78180644-78180666 CCTGACCAAGTTTTCCGGGCTCC No data
Right 1070642655 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG No data
1070642641_1070642655 30 Left 1070642641 10:78180605-78180627 CCAAGGCACTCTGTCCTTCCCTC No data
Right 1070642655 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG No data
1070642648_1070642655 4 Left 1070642648 10:78180631-78180653 CCGGTTACTGCAGCCTGACCAAG No data
Right 1070642655 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070642655 Original CRISPR CCGGGCTCCCCCTTCTCCCT GGG Intergenic
No off target data available for this crispr