ID: 1070642663

View in Genome Browser
Species Human (GRCh38)
Location 10:78180677-78180699
Sequence TGGGGACCCCATTCAATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070642651_1070642663 10 Left 1070642651 10:78180644-78180666 CCTGACCAAGTTTTCCGGGCTCC No data
Right 1070642663 10:78180677-78180699 TGGGGACCCCATTCAATCAGAGG No data
1070642647_1070642663 24 Left 1070642647 10:78180630-78180652 CCCGGTTACTGCAGCCTGACCAA No data
Right 1070642663 10:78180677-78180699 TGGGGACCCCATTCAATCAGAGG No data
1070642645_1070642663 30 Left 1070642645 10:78180624-78180646 CCTCCACCCGGTTACTGCAGCCT No data
Right 1070642663 10:78180677-78180699 TGGGGACCCCATTCAATCAGAGG No data
1070642654_1070642663 -4 Left 1070642654 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG No data
Right 1070642663 10:78180677-78180699 TGGGGACCCCATTCAATCAGAGG No data
1070642648_1070642663 23 Left 1070642648 10:78180631-78180653 CCGGTTACTGCAGCCTGACCAAG No data
Right 1070642663 10:78180677-78180699 TGGGGACCCCATTCAATCAGAGG No data
1070642646_1070642663 27 Left 1070642646 10:78180627-78180649 CCACCCGGTTACTGCAGCCTGAC No data
Right 1070642663 10:78180677-78180699 TGGGGACCCCATTCAATCAGAGG No data
1070642652_1070642663 5 Left 1070642652 10:78180649-78180671 CCAAGTTTTCCGGGCTCCCCCTT No data
Right 1070642663 10:78180677-78180699 TGGGGACCCCATTCAATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070642663 Original CRISPR TGGGGACCCCATTCAATCAG AGG Intergenic