ID: 1070643828

View in Genome Browser
Species Human (GRCh38)
Location 10:78187669-78187691
Sequence TAAAAGGCTTAGATGAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070643828_1070643831 -9 Left 1070643828 10:78187669-78187691 CCCTTCCTCATCTAAGCCTTTTA No data
Right 1070643831 10:78187683-78187705 AGCCTTTTACATCTCAGATCTGG No data
1070643828_1070643834 19 Left 1070643828 10:78187669-78187691 CCCTTCCTCATCTAAGCCTTTTA No data
Right 1070643834 10:78187711-78187733 TTTTCTGACTCCTTCAAGGCAGG No data
1070643828_1070643833 15 Left 1070643828 10:78187669-78187691 CCCTTCCTCATCTAAGCCTTTTA No data
Right 1070643833 10:78187707-78187729 GAATTTTTCTGACTCCTTCAAGG No data
1070643828_1070643835 20 Left 1070643828 10:78187669-78187691 CCCTTCCTCATCTAAGCCTTTTA No data
Right 1070643835 10:78187712-78187734 TTTCTGACTCCTTCAAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070643828 Original CRISPR TAAAAGGCTTAGATGAGGAA GGG (reversed) Intergenic
No off target data available for this crispr