ID: 1070644956

View in Genome Browser
Species Human (GRCh38)
Location 10:78195386-78195408
Sequence CCTGGCCTTCAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070644947_1070644956 -7 Left 1070644947 10:78195370-78195392 CCACCTCGCCTCCCTCCCTGGCC No data
Right 1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG No data
1070644943_1070644956 22 Left 1070644943 10:78195341-78195363 CCTGGGAGCTCTGCTTTCATCCC No data
Right 1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG No data
1070644942_1070644956 23 Left 1070644942 10:78195340-78195362 CCCTGGGAGCTCTGCTTTCATCC No data
Right 1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG No data
1070644945_1070644956 1 Left 1070644945 10:78195362-78195384 CCTCAGCGCCACCTCGCCTCCCT No data
Right 1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG No data
1070644948_1070644956 -10 Left 1070644948 10:78195373-78195395 CCTCGCCTCCCTCCCTGGCCTTC No data
Right 1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG No data
1070644941_1070644956 26 Left 1070644941 10:78195337-78195359 CCTCCCTGGGAGCTCTGCTTTCA No data
Right 1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG No data
1070644944_1070644956 2 Left 1070644944 10:78195361-78195383 CCCTCAGCGCCACCTCGCCTCCC No data
Right 1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070644956 Original CRISPR CCTGGCCTTCAGAAGGTGGA AGG Intergenic
No off target data available for this crispr