ID: 1070646398

View in Genome Browser
Species Human (GRCh38)
Location 10:78205048-78205070
Sequence CTTTCCTAGGGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070646398_1070646409 23 Left 1070646398 10:78205048-78205070 CCTTCCTCCTTCCCCTAGGAAAG No data
Right 1070646409 10:78205094-78205116 CCCCCACTCCACCTTCCTCCAGG No data
1070646398_1070646406 -7 Left 1070646398 10:78205048-78205070 CCTTCCTCCTTCCCCTAGGAAAG No data
Right 1070646406 10:78205064-78205086 AGGAAAGGCTAGCTTCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070646398 Original CRISPR CTTTCCTAGGGGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr