ID: 1070646531

View in Genome Browser
Species Human (GRCh38)
Location 10:78205692-78205714
Sequence CTTCACAGAAGCAGCTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070646528_1070646531 -1 Left 1070646528 10:78205670-78205692 CCTCCATCCTTGGTGTTCAAAGC No data
Right 1070646531 10:78205692-78205714 CTTCACAGAAGCAGCTCAGCAGG No data
1070646526_1070646531 6 Left 1070646526 10:78205663-78205685 CCTGTGCCCTCCATCCTTGGTGT No data
Right 1070646531 10:78205692-78205714 CTTCACAGAAGCAGCTCAGCAGG No data
1070646525_1070646531 7 Left 1070646525 10:78205662-78205684 CCCTGTGCCCTCCATCCTTGGTG No data
Right 1070646531 10:78205692-78205714 CTTCACAGAAGCAGCTCAGCAGG No data
1070646530_1070646531 -8 Left 1070646530 10:78205677-78205699 CCTTGGTGTTCAAAGCTTCACAG No data
Right 1070646531 10:78205692-78205714 CTTCACAGAAGCAGCTCAGCAGG No data
1070646522_1070646531 24 Left 1070646522 10:78205645-78205667 CCTCTCTGAACATCCGGCCCTGT No data
Right 1070646531 10:78205692-78205714 CTTCACAGAAGCAGCTCAGCAGG No data
1070646527_1070646531 0 Left 1070646527 10:78205669-78205691 CCCTCCATCCTTGGTGTTCAAAG No data
Right 1070646531 10:78205692-78205714 CTTCACAGAAGCAGCTCAGCAGG No data
1070646523_1070646531 11 Left 1070646523 10:78205658-78205680 CCGGCCCTGTGCCCTCCATCCTT No data
Right 1070646531 10:78205692-78205714 CTTCACAGAAGCAGCTCAGCAGG No data
1070646529_1070646531 -4 Left 1070646529 10:78205673-78205695 CCATCCTTGGTGTTCAAAGCTTC No data
Right 1070646531 10:78205692-78205714 CTTCACAGAAGCAGCTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070646531 Original CRISPR CTTCACAGAAGCAGCTCAGC AGG Intergenic
No off target data available for this crispr