ID: 1070647570

View in Genome Browser
Species Human (GRCh38)
Location 10:78212389-78212411
Sequence CAGTGGAGCTGGAGAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070647570_1070647580 21 Left 1070647570 10:78212389-78212411 CCTTCTGCTCTCCAGCTCCACTG No data
Right 1070647580 10:78212433-78212455 GGCCCTCAGGCCTGTGGTGTTGG No data
1070647570_1070647575 -9 Left 1070647570 10:78212389-78212411 CCTTCTGCTCTCCAGCTCCACTG No data
Right 1070647575 10:78212403-78212425 GCTCCACTGTCTGGCTGGGCTGG No data
1070647570_1070647578 8 Left 1070647570 10:78212389-78212411 CCTTCTGCTCTCCAGCTCCACTG No data
Right 1070647578 10:78212420-78212442 GGCTGGACTTGCTGGCCCTCAGG No data
1070647570_1070647577 0 Left 1070647570 10:78212389-78212411 CCTTCTGCTCTCCAGCTCCACTG No data
Right 1070647577 10:78212412-78212434 TCTGGCTGGGCTGGACTTGCTGG No data
1070647570_1070647579 15 Left 1070647570 10:78212389-78212411 CCTTCTGCTCTCCAGCTCCACTG No data
Right 1070647579 10:78212427-78212449 CTTGCTGGCCCTCAGGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070647570 Original CRISPR CAGTGGAGCTGGAGAGCAGA AGG (reversed) Intergenic
No off target data available for this crispr