ID: 1070648092

View in Genome Browser
Species Human (GRCh38)
Location 10:78215425-78215447
Sequence CTGAAATCCAATCTGGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070648092_1070648097 28 Left 1070648092 10:78215425-78215447 CCATTTGCCAGATTGGATTTCAG No data
Right 1070648097 10:78215476-78215498 TCTGTTGTCCTTAAGGATTTAGG No data
1070648092_1070648099 30 Left 1070648092 10:78215425-78215447 CCATTTGCCAGATTGGATTTCAG No data
Right 1070648099 10:78215478-78215500 TGTTGTCCTTAAGGATTTAGGGG No data
1070648092_1070648096 21 Left 1070648092 10:78215425-78215447 CCATTTGCCAGATTGGATTTCAG No data
Right 1070648096 10:78215469-78215491 GACTTTCTCTGTTGTCCTTAAGG No data
1070648092_1070648098 29 Left 1070648092 10:78215425-78215447 CCATTTGCCAGATTGGATTTCAG No data
Right 1070648098 10:78215477-78215499 CTGTTGTCCTTAAGGATTTAGGG No data
1070648092_1070648095 -1 Left 1070648092 10:78215425-78215447 CCATTTGCCAGATTGGATTTCAG No data
Right 1070648095 10:78215447-78215469 GTGATTGGTTTTAGACTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070648092 Original CRISPR CTGAAATCCAATCTGGCAAA TGG (reversed) Intergenic
No off target data available for this crispr