ID: 1070648098

View in Genome Browser
Species Human (GRCh38)
Location 10:78215477-78215499
Sequence CTGTTGTCCTTAAGGATTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070648092_1070648098 29 Left 1070648092 10:78215425-78215447 CCATTTGCCAGATTGGATTTCAG No data
Right 1070648098 10:78215477-78215499 CTGTTGTCCTTAAGGATTTAGGG No data
1070648093_1070648098 22 Left 1070648093 10:78215432-78215454 CCAGATTGGATTTCAGTGATTGG No data
Right 1070648098 10:78215477-78215499 CTGTTGTCCTTAAGGATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070648098 Original CRISPR CTGTTGTCCTTAAGGATTTA GGG Intergenic
No off target data available for this crispr