ID: 1070648612

View in Genome Browser
Species Human (GRCh38)
Location 10:78219159-78219181
Sequence TGTGCATGTTAAGCAGCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070648607_1070648612 24 Left 1070648607 10:78219112-78219134 CCACCAAAGACAAAGAGAAATCT No data
Right 1070648612 10:78219159-78219181 TGTGCATGTTAAGCAGCAGCCGG No data
1070648608_1070648612 21 Left 1070648608 10:78219115-78219137 CCAAAGACAAAGAGAAATCTATA No data
Right 1070648612 10:78219159-78219181 TGTGCATGTTAAGCAGCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070648612 Original CRISPR TGTGCATGTTAAGCAGCAGC CGG Intergenic
No off target data available for this crispr