ID: 1070649525

View in Genome Browser
Species Human (GRCh38)
Location 10:78224879-78224901
Sequence AGGCCCTGCAGAGCAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070649525_1070649526 -8 Left 1070649525 10:78224879-78224901 CCAGGCTCTGCTCTGCAGGGCCT No data
Right 1070649526 10:78224894-78224916 CAGGGCCTGATACAAGTTTTTGG No data
1070649525_1070649528 14 Left 1070649525 10:78224879-78224901 CCAGGCTCTGCTCTGCAGGGCCT No data
Right 1070649528 10:78224916-78224938 GCTAGTCCTGAAAGCCTCTCTGG No data
1070649525_1070649531 25 Left 1070649525 10:78224879-78224901 CCAGGCTCTGCTCTGCAGGGCCT No data
Right 1070649531 10:78224927-78224949 AAGCCTCTCTGGTCTGGTGCTGG No data
1070649525_1070649529 19 Left 1070649525 10:78224879-78224901 CCAGGCTCTGCTCTGCAGGGCCT No data
Right 1070649529 10:78224921-78224943 TCCTGAAAGCCTCTCTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070649525 Original CRISPR AGGCCCTGCAGAGCAGAGCC TGG (reversed) Intergenic
No off target data available for this crispr