ID: 1070649527

View in Genome Browser
Species Human (GRCh38)
Location 10:78224899-78224921
Sequence ACTAGCCAAAAACTTGTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070649527_1070649533 27 Left 1070649527 10:78224899-78224921 CCTGATACAAGTTTTTGGCTAGT No data
Right 1070649533 10:78224949-78224971 GCTGCCATCTAGTCTGCGAAAGG No data
1070649527_1070649529 -1 Left 1070649527 10:78224899-78224921 CCTGATACAAGTTTTTGGCTAGT No data
Right 1070649529 10:78224921-78224943 TCCTGAAAGCCTCTCTGGTCTGG No data
1070649527_1070649534 30 Left 1070649527 10:78224899-78224921 CCTGATACAAGTTTTTGGCTAGT No data
Right 1070649534 10:78224952-78224974 GCCATCTAGTCTGCGAAAGGTGG No data
1070649527_1070649531 5 Left 1070649527 10:78224899-78224921 CCTGATACAAGTTTTTGGCTAGT No data
Right 1070649531 10:78224927-78224949 AAGCCTCTCTGGTCTGGTGCTGG No data
1070649527_1070649528 -6 Left 1070649527 10:78224899-78224921 CCTGATACAAGTTTTTGGCTAGT No data
Right 1070649528 10:78224916-78224938 GCTAGTCCTGAAAGCCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070649527 Original CRISPR ACTAGCCAAAAACTTGTATC AGG (reversed) Intergenic
No off target data available for this crispr