ID: 1070649530

View in Genome Browser
Species Human (GRCh38)
Location 10:78224922-78224944
Sequence ACCAGACCAGAGAGGCTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070649530_1070649539 25 Left 1070649530 10:78224922-78224944 CCTGAAAGCCTCTCTGGTCTGGT No data
Right 1070649539 10:78224970-78224992 GGTGGCTCAGATGGAGGCCTGGG No data
1070649530_1070649534 7 Left 1070649530 10:78224922-78224944 CCTGAAAGCCTCTCTGGTCTGGT No data
Right 1070649534 10:78224952-78224974 GCCATCTAGTCTGCGAAAGGTGG No data
1070649530_1070649536 16 Left 1070649530 10:78224922-78224944 CCTGAAAGCCTCTCTGGTCTGGT No data
Right 1070649536 10:78224961-78224983 TCTGCGAAAGGTGGCTCAGATGG No data
1070649530_1070649538 24 Left 1070649530 10:78224922-78224944 CCTGAAAGCCTCTCTGGTCTGGT No data
Right 1070649538 10:78224969-78224991 AGGTGGCTCAGATGGAGGCCTGG No data
1070649530_1070649537 19 Left 1070649530 10:78224922-78224944 CCTGAAAGCCTCTCTGGTCTGGT No data
Right 1070649537 10:78224964-78224986 GCGAAAGGTGGCTCAGATGGAGG No data
1070649530_1070649533 4 Left 1070649530 10:78224922-78224944 CCTGAAAGCCTCTCTGGTCTGGT No data
Right 1070649533 10:78224949-78224971 GCTGCCATCTAGTCTGCGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070649530 Original CRISPR ACCAGACCAGAGAGGCTTTC AGG (reversed) Intergenic