ID: 1070649531

View in Genome Browser
Species Human (GRCh38)
Location 10:78224927-78224949
Sequence AAGCCTCTCTGGTCTGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070649527_1070649531 5 Left 1070649527 10:78224899-78224921 CCTGATACAAGTTTTTGGCTAGT No data
Right 1070649531 10:78224927-78224949 AAGCCTCTCTGGTCTGGTGCTGG No data
1070649525_1070649531 25 Left 1070649525 10:78224879-78224901 CCAGGCTCTGCTCTGCAGGGCCT No data
Right 1070649531 10:78224927-78224949 AAGCCTCTCTGGTCTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070649531 Original CRISPR AAGCCTCTCTGGTCTGGTGC TGG Intergenic
No off target data available for this crispr