ID: 1070649533

View in Genome Browser
Species Human (GRCh38)
Location 10:78224949-78224971
Sequence GCTGCCATCTAGTCTGCGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070649532_1070649533 -4 Left 1070649532 10:78224930-78224952 CCTCTCTGGTCTGGTGCTGGCTG No data
Right 1070649533 10:78224949-78224971 GCTGCCATCTAGTCTGCGAAAGG No data
1070649527_1070649533 27 Left 1070649527 10:78224899-78224921 CCTGATACAAGTTTTTGGCTAGT No data
Right 1070649533 10:78224949-78224971 GCTGCCATCTAGTCTGCGAAAGG No data
1070649530_1070649533 4 Left 1070649530 10:78224922-78224944 CCTGAAAGCCTCTCTGGTCTGGT No data
Right 1070649533 10:78224949-78224971 GCTGCCATCTAGTCTGCGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070649533 Original CRISPR GCTGCCATCTAGTCTGCGAA AGG Intergenic
No off target data available for this crispr