ID: 1070649537

View in Genome Browser
Species Human (GRCh38)
Location 10:78224964-78224986
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070649530_1070649537 19 Left 1070649530 10:78224922-78224944 CCTGAAAGCCTCTCTGGTCTGGT No data
Right 1070649537 10:78224964-78224986 GCGAAAGGTGGCTCAGATGGAGG No data
1070649532_1070649537 11 Left 1070649532 10:78224930-78224952 CCTCTCTGGTCTGGTGCTGGCTG No data
Right 1070649537 10:78224964-78224986 GCGAAAGGTGGCTCAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070649537 Original CRISPR GCGAAAGGTGGCTCAGATGG AGG Intergenic