ID: 1070649539

View in Genome Browser
Species Human (GRCh38)
Location 10:78224970-78224992
Sequence GGTGGCTCAGATGGAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070649532_1070649539 17 Left 1070649532 10:78224930-78224952 CCTCTCTGGTCTGGTGCTGGCTG No data
Right 1070649539 10:78224970-78224992 GGTGGCTCAGATGGAGGCCTGGG No data
1070649530_1070649539 25 Left 1070649530 10:78224922-78224944 CCTGAAAGCCTCTCTGGTCTGGT No data
Right 1070649539 10:78224970-78224992 GGTGGCTCAGATGGAGGCCTGGG No data
1070649535_1070649539 -6 Left 1070649535 10:78224953-78224975 CCATCTAGTCTGCGAAAGGTGGC No data
Right 1070649539 10:78224970-78224992 GGTGGCTCAGATGGAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070649539 Original CRISPR GGTGGCTCAGATGGAGGCCT GGG Intergenic