ID: 1070649540

View in Genome Browser
Species Human (GRCh38)
Location 10:78224984-78225006
Sequence AGGCCTGGGTAAGAGCGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070649535_1070649540 8 Left 1070649535 10:78224953-78224975 CCATCTAGTCTGCGAAAGGTGGC No data
Right 1070649540 10:78224984-78225006 AGGCCTGGGTAAGAGCGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070649540 Original CRISPR AGGCCTGGGTAAGAGCGTCC AGG Intergenic