ID: 1070650011

View in Genome Browser
Species Human (GRCh38)
Location 10:78228579-78228601
Sequence GTCTGGGAGCAGGTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070650011_1070650021 13 Left 1070650011 10:78228579-78228601 CCCTGCTCCACCTGCTCCCAGAC No data
Right 1070650021 10:78228615-78228637 TCTGTCTTCATCTCTGTCCCTGG No data
1070650011_1070650023 30 Left 1070650011 10:78228579-78228601 CCCTGCTCCACCTGCTCCCAGAC No data
Right 1070650023 10:78228632-78228654 CCCTGGAATCATTGACTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070650011 Original CRISPR GTCTGGGAGCAGGTGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr