ID: 1070653629

View in Genome Browser
Species Human (GRCh38)
Location 10:78255702-78255724
Sequence ATGGAAAAGCAGTAAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070653629_1070653637 23 Left 1070653629 10:78255702-78255724 CCAGCCTCTTACTGCTTTTCCAT No data
Right 1070653637 10:78255748-78255770 AGACCTCAGCCTTTCTTAGGAGG No data
1070653629_1070653636 20 Left 1070653629 10:78255702-78255724 CCAGCCTCTTACTGCTTTTCCAT No data
Right 1070653636 10:78255745-78255767 CTCAGACCTCAGCCTTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070653629 Original CRISPR ATGGAAAAGCAGTAAGAGGC TGG (reversed) Intergenic
No off target data available for this crispr