ID: 1070656808

View in Genome Browser
Species Human (GRCh38)
Location 10:78277276-78277298
Sequence CAGGCAGAGCAGAGGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070656808_1070656813 30 Left 1070656808 10:78277276-78277298 CCTGGGTGCCTCTGCTCTGCCTG No data
Right 1070656813 10:78277329-78277351 AATGCACACATGACAAATCCAGG No data
1070656808_1070656810 -9 Left 1070656808 10:78277276-78277298 CCTGGGTGCCTCTGCTCTGCCTG No data
Right 1070656810 10:78277290-78277312 CTCTGCCTGCCATAGCTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070656808 Original CRISPR CAGGCAGAGCAGAGGCACCC AGG (reversed) Intergenic
No off target data available for this crispr