ID: 1070660252

View in Genome Browser
Species Human (GRCh38)
Location 10:78300585-78300607
Sequence CTGGGGAAACAGAAAGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070660252_1070660255 -10 Left 1070660252 10:78300585-78300607 CCCTTCACTTTCTGTTTCCCCAG No data
Right 1070660255 10:78300598-78300620 GTTTCCCCAGGATTCACAACTGG 0: 1
1: 0
2: 1
3: 11
4: 132
1070660252_1070660256 -9 Left 1070660252 10:78300585-78300607 CCCTTCACTTTCTGTTTCCCCAG No data
Right 1070660256 10:78300599-78300621 TTTCCCCAGGATTCACAACTGGG 0: 1
1: 0
2: 4
3: 41
4: 600
1070660252_1070660261 12 Left 1070660252 10:78300585-78300607 CCCTTCACTTTCTGTTTCCCCAG No data
Right 1070660261 10:78300620-78300642 GGCTCCTCTTGCTGTGTTGGAGG 0: 1
1: 0
2: 2
3: 8
4: 209
1070660252_1070660262 13 Left 1070660252 10:78300585-78300607 CCCTTCACTTTCTGTTTCCCCAG No data
Right 1070660262 10:78300621-78300643 GCTCCTCTTGCTGTGTTGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 146
1070660252_1070660260 9 Left 1070660252 10:78300585-78300607 CCCTTCACTTTCTGTTTCCCCAG No data
Right 1070660260 10:78300617-78300639 CTGGGCTCCTCTTGCTGTGTTGG 0: 1
1: 0
2: 2
3: 20
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070660252 Original CRISPR CTGGGGAAACAGAAAGTGAA GGG (reversed) Intergenic
No off target data available for this crispr