ID: 1070660948

View in Genome Browser
Species Human (GRCh38)
Location 10:78304835-78304857
Sequence CACCAGGACTGGTGGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070660948_1070660962 30 Left 1070660948 10:78304835-78304857 CCCACTGCCCACCAGTCCTGGTG No data
Right 1070660962 10:78304888-78304910 AAGGGCTCTGGCTACCTCTGAGG No data
1070660948_1070660960 18 Left 1070660948 10:78304835-78304857 CCCACTGCCCACCAGTCCTGGTG No data
Right 1070660960 10:78304876-78304898 TCTCATCCACTCAAGGGCTCTGG No data
1070660948_1070660958 11 Left 1070660948 10:78304835-78304857 CCCACTGCCCACCAGTCCTGGTG No data
Right 1070660958 10:78304869-78304891 TGCATCATCTCATCCACTCAAGG No data
1070660948_1070660959 12 Left 1070660948 10:78304835-78304857 CCCACTGCCCACCAGTCCTGGTG No data
Right 1070660959 10:78304870-78304892 GCATCATCTCATCCACTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070660948 Original CRISPR CACCAGGACTGGTGGGCAGT GGG (reversed) Intergenic
No off target data available for this crispr