ID: 1070661636

View in Genome Browser
Species Human (GRCh38)
Location 10:78310728-78310750
Sequence CCTTTGACACAGAGGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070661630_1070661636 -9 Left 1070661630 10:78310714-78310736 CCTCCGTTGGGATGCCTTTGACA No data
Right 1070661636 10:78310728-78310750 CCTTTGACACAGAGGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070661636 Original CRISPR CCTTTGACACAGAGGGTGGC TGG Intergenic
No off target data available for this crispr