ID: 1070662078

View in Genome Browser
Species Human (GRCh38)
Location 10:78314151-78314173
Sequence CTGGTTACAGAAATCAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070662074_1070662078 3 Left 1070662074 10:78314125-78314147 CCTGGAAGCCAAGAGATTAGGGA No data
Right 1070662078 10:78314151-78314173 CTGGTTACAGAAATCAAACTGGG No data
1070662076_1070662078 -5 Left 1070662076 10:78314133-78314155 CCAAGAGATTAGGGAGAGCTGGT No data
Right 1070662078 10:78314151-78314173 CTGGTTACAGAAATCAAACTGGG No data
1070662071_1070662078 8 Left 1070662071 10:78314120-78314142 CCAAGCCTGGAAGCCAAGAGATT No data
Right 1070662078 10:78314151-78314173 CTGGTTACAGAAATCAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070662078 Original CRISPR CTGGTTACAGAAATCAAACT GGG Intergenic
No off target data available for this crispr