ID: 1070662189

View in Genome Browser
Species Human (GRCh38)
Location 10:78315001-78315023
Sequence CAGGTTGAACAGTAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070662189_1070662193 -3 Left 1070662189 10:78315001-78315023 CCTTCCTTCTACTGTTCAACCTG No data
Right 1070662193 10:78315021-78315043 CTGTAGAATAACAGGCACACAGG No data
1070662189_1070662194 20 Left 1070662189 10:78315001-78315023 CCTTCCTTCTACTGTTCAACCTG No data
Right 1070662194 10:78315044-78315066 TGAAATTGTCTTACCTTCATAGG No data
1070662189_1070662195 21 Left 1070662189 10:78315001-78315023 CCTTCCTTCTACTGTTCAACCTG No data
Right 1070662195 10:78315045-78315067 GAAATTGTCTTACCTTCATAGGG No data
1070662189_1070662196 22 Left 1070662189 10:78315001-78315023 CCTTCCTTCTACTGTTCAACCTG No data
Right 1070662196 10:78315046-78315068 AAATTGTCTTACCTTCATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070662189 Original CRISPR CAGGTTGAACAGTAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr