ID: 1070662193

View in Genome Browser
Species Human (GRCh38)
Location 10:78315021-78315043
Sequence CTGTAGAATAACAGGCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070662188_1070662193 11 Left 1070662188 10:78314987-78315009 CCAGGCACTCTGTTCCTTCCTTC No data
Right 1070662193 10:78315021-78315043 CTGTAGAATAACAGGCACACAGG No data
1070662189_1070662193 -3 Left 1070662189 10:78315001-78315023 CCTTCCTTCTACTGTTCAACCTG No data
Right 1070662193 10:78315021-78315043 CTGTAGAATAACAGGCACACAGG No data
1070662190_1070662193 -7 Left 1070662190 10:78315005-78315027 CCTTCTACTGTTCAACCTGTAGA No data
Right 1070662193 10:78315021-78315043 CTGTAGAATAACAGGCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070662193 Original CRISPR CTGTAGAATAACAGGCACAC AGG Intergenic
No off target data available for this crispr