ID: 1070662194

View in Genome Browser
Species Human (GRCh38)
Location 10:78315044-78315066
Sequence TGAAATTGTCTTACCTTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070662190_1070662194 16 Left 1070662190 10:78315005-78315027 CCTTCTACTGTTCAACCTGTAGA No data
Right 1070662194 10:78315044-78315066 TGAAATTGTCTTACCTTCATAGG No data
1070662189_1070662194 20 Left 1070662189 10:78315001-78315023 CCTTCCTTCTACTGTTCAACCTG No data
Right 1070662194 10:78315044-78315066 TGAAATTGTCTTACCTTCATAGG No data
1070662192_1070662194 1 Left 1070662192 10:78315020-78315042 CCTGTAGAATAACAGGCACACAG No data
Right 1070662194 10:78315044-78315066 TGAAATTGTCTTACCTTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070662194 Original CRISPR TGAAATTGTCTTACCTTCAT AGG Intergenic
No off target data available for this crispr