ID: 1070662196

View in Genome Browser
Species Human (GRCh38)
Location 10:78315046-78315068
Sequence AAATTGTCTTACCTTCATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070662189_1070662196 22 Left 1070662189 10:78315001-78315023 CCTTCCTTCTACTGTTCAACCTG No data
Right 1070662196 10:78315046-78315068 AAATTGTCTTACCTTCATAGGGG No data
1070662192_1070662196 3 Left 1070662192 10:78315020-78315042 CCTGTAGAATAACAGGCACACAG No data
Right 1070662196 10:78315046-78315068 AAATTGTCTTACCTTCATAGGGG No data
1070662190_1070662196 18 Left 1070662190 10:78315005-78315027 CCTTCTACTGTTCAACCTGTAGA No data
Right 1070662196 10:78315046-78315068 AAATTGTCTTACCTTCATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070662196 Original CRISPR AAATTGTCTTACCTTCATAG GGG Intergenic
No off target data available for this crispr