ID: 1070663544

View in Genome Browser
Species Human (GRCh38)
Location 10:78327830-78327852
Sequence AATACTACACACACCAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070663544_1070663551 5 Left 1070663544 10:78327830-78327852 CCCTGGTTGGTGTGTGTAGTATT No data
Right 1070663551 10:78327858-78327880 GTGGTGGCAGCAGTGGTGGAGGG No data
1070663544_1070663552 16 Left 1070663544 10:78327830-78327852 CCCTGGTTGGTGTGTGTAGTATT No data
Right 1070663552 10:78327869-78327891 AGTGGTGGAGGGCCAACTCTTGG No data
1070663544_1070663553 17 Left 1070663544 10:78327830-78327852 CCCTGGTTGGTGTGTGTAGTATT No data
Right 1070663553 10:78327870-78327892 GTGGTGGAGGGCCAACTCTTGGG No data
1070663544_1070663548 -2 Left 1070663544 10:78327830-78327852 CCCTGGTTGGTGTGTGTAGTATT No data
Right 1070663548 10:78327851-78327873 TTTATTTGTGGTGGCAGCAGTGG No data
1070663544_1070663550 4 Left 1070663544 10:78327830-78327852 CCCTGGTTGGTGTGTGTAGTATT No data
Right 1070663550 10:78327857-78327879 TGTGGTGGCAGCAGTGGTGGAGG No data
1070663544_1070663549 1 Left 1070663544 10:78327830-78327852 CCCTGGTTGGTGTGTGTAGTATT No data
Right 1070663549 10:78327854-78327876 ATTTGTGGTGGCAGCAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070663544 Original CRISPR AATACTACACACACCAACCA GGG (reversed) Intergenic
No off target data available for this crispr