ID: 1070664359

View in Genome Browser
Species Human (GRCh38)
Location 10:78332926-78332948
Sequence CAGGCCAACCTGAGGTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070664354_1070664359 -5 Left 1070664354 10:78332908-78332930 CCAGCCTAAAATAAGGGCCAGGC No data
Right 1070664359 10:78332926-78332948 CAGGCCAACCTGAGGTGTGGTGG No data
1070664345_1070664359 25 Left 1070664345 10:78332878-78332900 CCAGAAATCCCACATATTGTCAA No data
Right 1070664359 10:78332926-78332948 CAGGCCAACCTGAGGTGTGGTGG No data
1070664350_1070664359 16 Left 1070664350 10:78332887-78332909 CCACATATTGTCAAGGGGAAGCC No data
Right 1070664359 10:78332926-78332948 CAGGCCAACCTGAGGTGTGGTGG No data
1070664349_1070664359 17 Left 1070664349 10:78332886-78332908 CCCACATATTGTCAAGGGGAAGC No data
Right 1070664359 10:78332926-78332948 CAGGCCAACCTGAGGTGTGGTGG No data
1070664343_1070664359 29 Left 1070664343 10:78332874-78332896 CCCTCCAGAAATCCCACATATTG No data
Right 1070664359 10:78332926-78332948 CAGGCCAACCTGAGGTGTGGTGG No data
1070664355_1070664359 -9 Left 1070664355 10:78332912-78332934 CCTAAAATAAGGGCCAGGCCAAC No data
Right 1070664359 10:78332926-78332948 CAGGCCAACCTGAGGTGTGGTGG No data
1070664344_1070664359 28 Left 1070664344 10:78332875-78332897 CCTCCAGAAATCCCACATATTGT No data
Right 1070664359 10:78332926-78332948 CAGGCCAACCTGAGGTGTGGTGG No data
1070664342_1070664359 30 Left 1070664342 10:78332873-78332895 CCCCTCCAGAAATCCCACATATT No data
Right 1070664359 10:78332926-78332948 CAGGCCAACCTGAGGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070664359 Original CRISPR CAGGCCAACCTGAGGTGTGG TGG Intergenic
No off target data available for this crispr