ID: 1070665248

View in Genome Browser
Species Human (GRCh38)
Location 10:78338019-78338041
Sequence CTGGAAAGACAGCCTCCGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070665248_1070665249 -8 Left 1070665248 10:78338019-78338041 CCTTTCGGAGGCTGTCTTTCCAG No data
Right 1070665249 10:78338034-78338056 CTTTCCAGCTGCAAGTGCTCTGG No data
1070665248_1070665252 -3 Left 1070665248 10:78338019-78338041 CCTTTCGGAGGCTGTCTTTCCAG No data
Right 1070665252 10:78338039-78338061 CAGCTGCAAGTGCTCTGGGCAGG No data
1070665248_1070665250 -7 Left 1070665248 10:78338019-78338041 CCTTTCGGAGGCTGTCTTTCCAG No data
Right 1070665250 10:78338035-78338057 TTTCCAGCTGCAAGTGCTCTGGG No data
1070665248_1070665254 7 Left 1070665248 10:78338019-78338041 CCTTTCGGAGGCTGTCTTTCCAG No data
Right 1070665254 10:78338049-78338071 TGCTCTGGGCAGGCTGGAAACGG No data
1070665248_1070665255 29 Left 1070665248 10:78338019-78338041 CCTTTCGGAGGCTGTCTTTCCAG No data
Right 1070665255 10:78338071-78338093 GTGTTCTGAAGAGCCGCATGAGG No data
1070665248_1070665253 1 Left 1070665248 10:78338019-78338041 CCTTTCGGAGGCTGTCTTTCCAG No data
Right 1070665253 10:78338043-78338065 TGCAAGTGCTCTGGGCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070665248 Original CRISPR CTGGAAAGACAGCCTCCGAA AGG (reversed) Intergenic
No off target data available for this crispr