ID: 1070667022

View in Genome Browser
Species Human (GRCh38)
Location 10:78352197-78352219
Sequence ATCTCTTAGATAATGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070667015_1070667022 23 Left 1070667015 10:78352151-78352173 CCAGGGCTTGGTGTCTGGTGGAC No data
Right 1070667022 10:78352197-78352219 ATCTCTTAGATAATGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070667022 Original CRISPR ATCTCTTAGATAATGGTGGT TGG Intergenic
No off target data available for this crispr