ID: 1070668865

View in Genome Browser
Species Human (GRCh38)
Location 10:78364139-78364161
Sequence CCCGCAGGGTCTCTGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070668865_1070668873 -1 Left 1070668865 10:78364139-78364161 CCAGCCTTCAGAGACCCTGCGGG No data
Right 1070668873 10:78364161-78364183 GTAGAGGGATACACTAGACAGGG No data
1070668865_1070668872 -2 Left 1070668865 10:78364139-78364161 CCAGCCTTCAGAGACCCTGCGGG No data
Right 1070668872 10:78364160-78364182 GGTAGAGGGATACACTAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070668865 Original CRISPR CCCGCAGGGTCTCTGAAGGC TGG (reversed) Intergenic
No off target data available for this crispr