ID: 1070669291

View in Genome Browser
Species Human (GRCh38)
Location 10:78366827-78366849
Sequence TACGAACACCAGAGACTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070669291_1070669293 -2 Left 1070669291 10:78366827-78366849 CCTTAGAGTCTCTGGTGTTCGTA No data
Right 1070669293 10:78366848-78366870 TATGATAAAAGTACTAGGCTTGG No data
1070669291_1070669292 -7 Left 1070669291 10:78366827-78366849 CCTTAGAGTCTCTGGTGTTCGTA No data
Right 1070669292 10:78366843-78366865 GTTCGTATGATAAAAGTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070669291 Original CRISPR TACGAACACCAGAGACTCTA AGG (reversed) Intergenic
No off target data available for this crispr