ID: 1070669660

View in Genome Browser
Species Human (GRCh38)
Location 10:78369085-78369107
Sequence CCCCAGCGAGGGCTTCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070669660_1070669667 26 Left 1070669660 10:78369085-78369107 CCTCCTGGAAGCCCTCGCTGGGG No data
Right 1070669667 10:78369134-78369156 TTCATCCCATGGTTCTTCCTAGG No data
1070669660_1070669666 15 Left 1070669660 10:78369085-78369107 CCTCCTGGAAGCCCTCGCTGGGG No data
Right 1070669666 10:78369123-78369145 TGCTCTATATCTTCATCCCATGG No data
1070669660_1070669668 27 Left 1070669660 10:78369085-78369107 CCTCCTGGAAGCCCTCGCTGGGG No data
Right 1070669668 10:78369135-78369157 TCATCCCATGGTTCTTCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070669660 Original CRISPR CCCCAGCGAGGGCTTCCAGG AGG (reversed) Intergenic