ID: 1070670353

View in Genome Browser
Species Human (GRCh38)
Location 10:78373299-78373321
Sequence GGACCCAAACTAACACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070670345_1070670353 29 Left 1070670345 10:78373247-78373269 CCCTAATAAATTCCTCGCACGTT No data
Right 1070670353 10:78373299-78373321 GGACCCAAACTAACACAAGCAGG No data
1070670351_1070670353 1 Left 1070670351 10:78373275-78373297 CCATATGGGTGTCTGCTTCTTGC No data
Right 1070670353 10:78373299-78373321 GGACCCAAACTAACACAAGCAGG No data
1070670350_1070670353 2 Left 1070670350 10:78373274-78373296 CCCATATGGGTGTCTGCTTCTTG No data
Right 1070670353 10:78373299-78373321 GGACCCAAACTAACACAAGCAGG No data
1070670347_1070670353 17 Left 1070670347 10:78373259-78373281 CCTCGCACGTTGCATCCCATATG No data
Right 1070670353 10:78373299-78373321 GGACCCAAACTAACACAAGCAGG No data
1070670346_1070670353 28 Left 1070670346 10:78373248-78373270 CCTAATAAATTCCTCGCACGTTG No data
Right 1070670353 10:78373299-78373321 GGACCCAAACTAACACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070670353 Original CRISPR GGACCCAAACTAACACAAGC AGG Intergenic
No off target data available for this crispr