ID: 1070670379

View in Genome Browser
Species Human (GRCh38)
Location 10:78373504-78373526
Sequence GGTGCTGGAGCAACACTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070670374_1070670379 4 Left 1070670374 10:78373477-78373499 CCCTGTTGATGGCTGTGGAAGAG No data
Right 1070670379 10:78373504-78373526 GGTGCTGGAGCAACACTTCCTGG No data
1070670375_1070670379 3 Left 1070670375 10:78373478-78373500 CCTGTTGATGGCTGTGGAAGAGG No data
Right 1070670379 10:78373504-78373526 GGTGCTGGAGCAACACTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070670379 Original CRISPR GGTGCTGGAGCAACACTTCC TGG Intergenic
No off target data available for this crispr