ID: 1070670603

View in Genome Browser
Species Human (GRCh38)
Location 10:78374900-78374922
Sequence GGACTGGGGAGTTACAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070670603_1070670613 7 Left 1070670603 10:78374900-78374922 CCCTCACTGTAACTCCCCAGTCC No data
Right 1070670613 10:78374930-78374952 TAACTTATGTTTGGAGATGATGG No data
1070670603_1070670609 -2 Left 1070670603 10:78374900-78374922 CCCTCACTGTAACTCCCCAGTCC No data
Right 1070670609 10:78374921-78374943 CCCCCATGCTAACTTATGTTTGG No data
1070670603_1070670614 13 Left 1070670603 10:78374900-78374922 CCCTCACTGTAACTCCCCAGTCC No data
Right 1070670614 10:78374936-78374958 ATGTTTGGAGATGATGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070670603 Original CRISPR GGACTGGGGAGTTACAGTGA GGG (reversed) Intergenic
No off target data available for this crispr