ID: 1070670604

View in Genome Browser
Species Human (GRCh38)
Location 10:78374901-78374923
Sequence GGGACTGGGGAGTTACAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070670604_1070670609 -3 Left 1070670604 10:78374901-78374923 CCTCACTGTAACTCCCCAGTCCC No data
Right 1070670609 10:78374921-78374943 CCCCCATGCTAACTTATGTTTGG No data
1070670604_1070670613 6 Left 1070670604 10:78374901-78374923 CCTCACTGTAACTCCCCAGTCCC No data
Right 1070670613 10:78374930-78374952 TAACTTATGTTTGGAGATGATGG No data
1070670604_1070670614 12 Left 1070670604 10:78374901-78374923 CCTCACTGTAACTCCCCAGTCCC No data
Right 1070670614 10:78374936-78374958 ATGTTTGGAGATGATGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070670604 Original CRISPR GGGACTGGGGAGTTACAGTG AGG (reversed) Intergenic
No off target data available for this crispr