ID: 1070670609

View in Genome Browser
Species Human (GRCh38)
Location 10:78374921-78374943
Sequence CCCCCATGCTAACTTATGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070670601_1070670609 4 Left 1070670601 10:78374894-78374916 CCTCTCCCCTCACTGTAACTCCC No data
Right 1070670609 10:78374921-78374943 CCCCCATGCTAACTTATGTTTGG No data
1070670604_1070670609 -3 Left 1070670604 10:78374901-78374923 CCTCACTGTAACTCCCCAGTCCC No data
Right 1070670609 10:78374921-78374943 CCCCCATGCTAACTTATGTTTGG No data
1070670603_1070670609 -2 Left 1070670603 10:78374900-78374922 CCCTCACTGTAACTCCCCAGTCC No data
Right 1070670609 10:78374921-78374943 CCCCCATGCTAACTTATGTTTGG No data
1070670602_1070670609 -1 Left 1070670602 10:78374899-78374921 CCCCTCACTGTAACTCCCCAGTC No data
Right 1070670609 10:78374921-78374943 CCCCCATGCTAACTTATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070670609 Original CRISPR CCCCCATGCTAACTTATGTT TGG Intergenic
No off target data available for this crispr