ID: 1070670614

View in Genome Browser
Species Human (GRCh38)
Location 10:78374936-78374958
Sequence ATGTTTGGAGATGATGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070670605_1070670614 -1 Left 1070670605 10:78374914-78374936 CCCCAGTCCCCCATGCTAACTTA No data
Right 1070670614 10:78374936-78374958 ATGTTTGGAGATGATGGAGCAGG No data
1070670611_1070670614 -10 Left 1070670611 10:78374923-78374945 CCCATGCTAACTTATGTTTGGAG No data
Right 1070670614 10:78374936-78374958 ATGTTTGGAGATGATGGAGCAGG No data
1070670602_1070670614 14 Left 1070670602 10:78374899-78374921 CCCCTCACTGTAACTCCCCAGTC No data
Right 1070670614 10:78374936-78374958 ATGTTTGGAGATGATGGAGCAGG No data
1070670608_1070670614 -8 Left 1070670608 10:78374921-78374943 CCCCCATGCTAACTTATGTTTGG No data
Right 1070670614 10:78374936-78374958 ATGTTTGGAGATGATGGAGCAGG No data
1070670601_1070670614 19 Left 1070670601 10:78374894-78374916 CCTCTCCCCTCACTGTAACTCCC No data
Right 1070670614 10:78374936-78374958 ATGTTTGGAGATGATGGAGCAGG No data
1070670610_1070670614 -9 Left 1070670610 10:78374922-78374944 CCCCATGCTAACTTATGTTTGGA No data
Right 1070670614 10:78374936-78374958 ATGTTTGGAGATGATGGAGCAGG No data
1070670607_1070670614 -3 Left 1070670607 10:78374916-78374938 CCAGTCCCCCATGCTAACTTATG No data
Right 1070670614 10:78374936-78374958 ATGTTTGGAGATGATGGAGCAGG No data
1070670603_1070670614 13 Left 1070670603 10:78374900-78374922 CCCTCACTGTAACTCCCCAGTCC No data
Right 1070670614 10:78374936-78374958 ATGTTTGGAGATGATGGAGCAGG No data
1070670606_1070670614 -2 Left 1070670606 10:78374915-78374937 CCCAGTCCCCCATGCTAACTTAT No data
Right 1070670614 10:78374936-78374958 ATGTTTGGAGATGATGGAGCAGG No data
1070670604_1070670614 12 Left 1070670604 10:78374901-78374923 CCTCACTGTAACTCCCCAGTCCC No data
Right 1070670614 10:78374936-78374958 ATGTTTGGAGATGATGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070670614 Original CRISPR ATGTTTGGAGATGATGGAGC AGG Intergenic
No off target data available for this crispr