ID: 1070670912

View in Genome Browser
Species Human (GRCh38)
Location 10:78376621-78376643
Sequence CCCTGTCAGGCAGTGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070670907_1070670912 -5 Left 1070670907 10:78376603-78376625 CCATGTCAGCTGCTCTGTCCCTG No data
Right 1070670912 10:78376621-78376643 CCCTGTCAGGCAGTGTGTTGGGG No data
1070670905_1070670912 24 Left 1070670905 10:78376574-78376596 CCTCCACATATCTCGTGTGTTCA No data
Right 1070670912 10:78376621-78376643 CCCTGTCAGGCAGTGTGTTGGGG No data
1070670906_1070670912 21 Left 1070670906 10:78376577-78376599 CCACATATCTCGTGTGTTCAGCA No data
Right 1070670912 10:78376621-78376643 CCCTGTCAGGCAGTGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070670912 Original CRISPR CCCTGTCAGGCAGTGTGTTG GGG Intergenic
No off target data available for this crispr