ID: 1070673812

View in Genome Browser
Species Human (GRCh38)
Location 10:78398190-78398212
Sequence CTGGGAGGACACGATGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070673812_1070673818 9 Left 1070673812 10:78398190-78398212 CCAACTACATCGTGTCCTCCCAG No data
Right 1070673818 10:78398222-78398244 GGAAGCCCTCAGACACTGACTGG No data
1070673812_1070673821 23 Left 1070673812 10:78398190-78398212 CCAACTACATCGTGTCCTCCCAG No data
Right 1070673821 10:78398236-78398258 ACTGACTGGTCCACCTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070673812 Original CRISPR CTGGGAGGACACGATGTAGT TGG (reversed) Intergenic
No off target data available for this crispr