ID: 1070674800

View in Genome Browser
Species Human (GRCh38)
Location 10:78405202-78405224
Sequence CACATTGCACAGATGAAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070674798_1070674800 29 Left 1070674798 10:78405150-78405172 CCATTATTTCATTTGCTCTTCAC No data
Right 1070674800 10:78405202-78405224 CACATTGCACAGATGAAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070674800 Original CRISPR CACATTGCACAGATGAAACT CGG Intergenic
No off target data available for this crispr